Marker Overview
NameBM138
Marker Typemicrosatellite
Accessionn/a
OrganismPhaseolus vulgaris (common bean)
Source Description
Primer1 Sequence
>BM138.p1
TGTCCCTAAGAACGAATATGGAATC
Primer2 Sequence
>BM138.p2
GAATCAAGCAACCTTGGATCATAAC
Genetic Map(s)
Cerinza_x_G24404_a linkage group: Cerinza_x_G24404_a-B01
PvConsensus_GaleanoFernandez2011_a [CMap] linkage group: PvConsensus_GaleanoFernandez2011_a-Pv05 [CMap]
PvMcCleanNDSU2007 [CMap] linkage group: PvMcCleanNDSU2007-5 [CMap]
DOR364_x_BAT477_a linkage group: DOR364_x_BAT477_a-B05
Publication(s)Primary: Gaitan-Solis, Duque et al., 2002a
Blair, Galeano et al., 2012a
Blair, Iriarte et al., 2006a
Galeano, Fernandez et al., 2011a
Sequence length381bp
Sequence
>BM138 ID=BM138|Name=BM138|organism=Phaseolus vulgaris|type=microsatellite
ACCAATCTTCCTCCTTCCATAACTTGGAACCAACAAGTTCCACTTAGTGAGCCATGGATGACCGAATCGACGACGACGAC
AGTGACAAGGAGTTGTCGGGCTTGACCTCTCTTCCACCTCACCGGAAAGCCCATTCCTACAGCCAACAGCTGCGAGGCGC
CTCCACGCACAAACGACACCAGCGAGTCCGAAAGCACAGTCTCGACGACAGCCGTATATCCTCCAACATTGAGTCTTCGT
TTTATAACTCCGACTCCGACGACGACATATTTTCCCGTTCATCCTCTACAAACCCTGCTGGTGGTGACGAAAGAGTATAA
TGACAATGAGGCGACACAGTATCAACCATTGCAGGAATTCGTAGGCGCTGGGGGGAGGGGT
Marker Positions
NameBM138
Physical position(s)
Assembly version Chromosome Start End View Position
phavu.G19833.gnm1 phavu.Chr03 11433194 11433381 [GBrowse]
Map Position(s)
map: PvMcCleanNDSU2007linkage group: PvMcCleanNDSU2007-5position: 31cM [CMap]
map: PvConsensus_GaleanoFernandez2011_alinkage group: PvConsensus_GaleanoFernandez2011_a-Pv05position: 84.76cM [CMap]
map: DOR364_x_BAT477_alinkage group: DOR364_x_BAT477_a-B05position: 27.3cM
map: Cerinza_x_G24404_alinkage group: Cerinza_x_G24404_a-B01position: 5.6cM